Abstracto
- Cilevirus infection in ornamental hibiscus was previously reported from Hawaii (Melzer et al. 2013) and Florida (Roy et al. 2018). According to the guidelines of the International Committee on Taxonomy of Viruses, Hibiscus-infecting cilevirus is described as a hibiscus strain of Citrus leprosis virus C2 (CiLV-C2H) because it shares a 92% amino acid identity with CiLV-C2. Natural infection of hibiscus by CiLV-C2 was reported in Colombia (Roy et al. 2015), but there was no report of CiLV-C2H infection in Citrus spp. In February 2015, two sweet orange (Citrus sinensis L.) samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia. Samples were assayed to validate a newly developed multiplex reverse-transcription polymerase chain reaction (RT-PCR) assay for detection of Cilevirus (CiLV-C, -C2, and -C2H), Dichorhavirus (CiLV-N), and Higrevirus (hibiscus green spot virus 2 [HGSV-2]) associated with CiL disease (Roy et al. 2015). CiL-infected samples from Colombia tested positive with CiLV-C2 and -C2H specific primers in a RT-PCR assay (Roy et al. 2013a, 2018), but not with the primers specific for CiLV-C, CiLV-N, and HGSV-2 (Roy et al. 2015). The incidence and distribution of CiLV-C2H in Colombia were determined with primers specific to the putative coat protein gene (CPG) of CiLV-C2H (accession MG253805) (CiLV-C2H-F, 5′TCAAGCACCTCGTCAACGTGTTAA3′; and CiLV-C2H-R, 5′ATGTTTACTCTCCCTGCTCTTCTGC3′) in a RT-PCR assay. The newly developed primer pair successfully amplified 626 nt of CPG sequence from both samples. In addition, 14 sweet orange samples that were archived in 2012 from the same location of Meta and Casanare were tested. The species-specific RT-PCR assays yielded CiLV-C2 specific 795-nt amplicon from all 14 samples and 626-nt amplicon specific to CiLV-C2H sequences from 12 samples. RT-PCR products were purified, cloned, and sequenced. BLAST analysis of CiLV-C2H amplicon sequence (MG637133) shared 98% nucleotide identity with CiLV-C2H Hawaiian isolate (KC626783) but only 86% with CiLV-C2 (JX000024). CiLV-C2 specific amplicon showed 99% nucleotide identity with CiLV-C2 (MG637132). These results confirmed the presence of CiLV-C2H in mixed infection with CiLV-C2 prior to 2012.
